Top » Catalog » SNPs » M4703

$18.00

M4703
[M4703]

M4703
hg38 Position: ChrY:8534182..8534182
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: E1b1a1a1a1c1
Comments: Below L485; aka V1891/Z1291
Forward Primer: M4703_F TCCACAGTGACCCTCAACAG
Reverse Primer: M4703_R CCAGGGACCCTTCAGCTATC
Reviews

Customers who bought this product also purchased
V38
V38
CTS5788
CTS5788
CTS668
CTS668
CTS2754
CTS2754
M4670
M4670
Z5966
Z5966
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies