Top » Catalog » SNPs » M4703

$18.00

M4703
[M4703]

M4703
hg38 Position: ChrY:8534182..8534182
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: E1b1a1a1a1c1
Comments: Below L485; aka V1891/Z1291
Forward Primer: M4703_F TCCACAGTGACCCTCAACAG
Reverse Primer: M4703_R CCAGGGACCCTTCAGCTATC
Reviews

Customers who bought this product also purchased
E Superclade Panel
E Superclade Panel
CTS5961
CTS5961
M9
M9
M96
M96
M4689
M4689
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies