Top » Catalog » SNPs » M4703

$18.00

M4703
[M4703]

M4703
hg38 Position: ChrY:8534182..8534182
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: E1b1a1a1a1c1
Comments: Below L485; aka V1891/Z1291
Forward Primer: M4703_F TCCACAGTGACCCTCAACAG
Reverse Primer: M4703_R CCAGGGACCCTTCAGCTATC
Reviews

Customers who bought this product also purchased
M4437
M4437
Z1687
Z1687
Z5982
Z5982
CTS9806
CTS9806
Z5978
Z5978
Z1704
Z1704
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies