Top » Catalog » SNPs » V1994

$18.00

V1994
[V1994]

V1994
hg38 Position: ChrY:8575466..8575466
Ancestral: C
Derived: T
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b1a2a1~ (not listed)
Comments: Below Y28840
Forward Primer: V1994_F GGGTTTTCTGGGTCTTGCTC
Reverse Primer: V1994_R CCCCACAAAAAGACCACAAC
Reviews

Customers who bought this product also purchased
P177
P177
M172
M172
Y77409
Y77409
V13
V13
CTS11248
CTS11248
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies