Top » Catalog » SNPs » V1994

$18.00

V1994
[V1994]

V1994
hg38 Position: ChrY:8575466..8575466
Ancestral: C
Derived: T
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b1a2a1~ (not listed)
Comments: Below Y28840
Forward Primer: V1994_F GGGTTTTCTGGGTCTTGCTC
Reverse Primer: V1994_R CCCCACAAAAAGACCACAAC
Reviews

Customers who bought this product also purchased
V1061
V1061
M96
M96
E Superclade Panel
E Superclade Panel
M75
M75
L608
L608
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies