Top » Catalog » SNPs » V1994

$18.00

V1994
[V1994]

V1994
hg38 Position: ChrY:8575466..8575466
Ancestral: C
Derived: T
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b1a2a1~ (not listed)
Comments: Below Y28840
Forward Primer: V1994_F GGGTTTTCTGGGTCTTGCTC
Reverse Primer: V1994_R CCCCACAAAAAGACCACAAC
Reviews

Customers who bought this product also purchased
M267
M267
Y28840
Y28840
V22
V22
CTS8432
CTS8432
M96
M96
V1061
V1061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies