Top » Catalog » SNPs » CTS8392

$18.00

CTS8392
[CTS8392]

CTS8392
hg38 Position: ChrY:15863199..15863199
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E2b1a1
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS8392_F CCTCTGCAGGCCTTTGAC
Reverse Primer: CTS8392_R CTGCACTCTCATCAGTGATAACC
Reviews

Customers who bought this product also purchased
M215
M215
FT251291
FT251291
M75
M75
FT19187
FT19187
M96
M96
BY69129
BY69129
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies