Top » Catalog » SNPs » L419

$18.00

L419
[L419]

L419
hg38 Position: ChrY:13092973..13092973
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: A1b1
Comments: Found in a hg A-M13 WTY participant
Forward Primer: L419_F GTCAGGGGAAATTGCAGTG
Reverse Primer: L419_R ACAGCTTTGAGGTCATGCAG
Reviews

Customers who bought this product also purchased
F3707
F3707
FGC8044
FGC8044
M304
M304
L901
L901
F1977
F1977
M218
M218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies