Top » Catalog » SNPs » L419

$18.00

L419
[L419]

L419
hg38 Position: ChrY:13092973..13092973
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: A1b1
Comments: Found in a hg A-M13 WTY participant
Forward Primer: L419_F GTCAGGGGAAATTGCAGTG
Reverse Primer: L419_R ACAGCTTTGAGGTCATGCAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
M31
M31
L1089
L1089
F1977
F1977
M218
M218
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies