Top » Catalog » SNPs » FGC5639

$18.00

FGC5639
[FGC5639]

FGC5639
hg38 Position: ChrY:14408646..14408646
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f2a (no listed)
Comments: Downstream FGC5628
Forward Primer: FGC5639_F TGTTTAGCTGTAAAAAGCCATCTG
Reverse Primer: FGC5639_R GGCCACCTCTTTCTTAAATAGTCC
Reviews

Customers who bought this product also purchased
L1066
L1066
Z253
Z253
Z2185
Z2185
Z39589
Z39589
S868
S868
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies