Top » Catalog » SNPs » FGC5639

$18.00

FGC5639
[FGC5639]

FGC5639
hg38 Position: ChrY:14408646..14408646
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f2a (no listed)
Comments: Downstream FGC5628
Forward Primer: FGC5639_F TGTTTAGCTGTAAAAAGCCATCTG
Reverse Primer: FGC5639_R GGCCACCTCTTTCTTAAATAGTCC
Reviews

Customers who bought this product also purchased
L1066
L1066
L513
L513
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF21
DF21
DC38
DC38
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies