Top » Catalog » SNPs » CTS6838

$18.00

CTS6838
[CTS6838]

CTS6838
hg38 Position: ChrY:15026607..15026607
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1
Comments: Syn. with CTS11722; downstream L21
Forward Primer: CTS6838_F TGCATCTTGATCTTAGTCAAGTCC
Reverse Primer: CTS6838_R TGGCAAAATGTCTTCATGAGG
Reviews

Customers who bought this product also purchased
YCAII
YCAII
L1065
L1065
DYF397
DYF397
FGC173
FGC173
DYS725
DYS725
FGC10125
FGC10125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies