Top » Catalog » SNPs » S735

$18.00

S735
[S735]

S735
hg38 Position: ChrY:15134765..15134765
Ancestral: G
Derived: C
Reference: Jim Wilson
ISOGG Haplogroup: R1b1a1a2a1a2c1k1
Comments: Aka. CTS7030. below L21
Forward Primer: S735_F CAAAAGAGACAAAGAAAAGCACC
Reverse Primer: S735_R CAAGATGGACTCACTTTGAGTTCTAC
Reviews

Customers who bought this product also purchased
FGC10125
FGC10125
DYF399X
DYF399X
CTS6838
CTS6838
DYS464X
DYS464X
R1b-L1065 McAfee - McDuffee Panel
R1b-L1065 McAfee - McDuffee Panel
DYS385
DYS385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies