Top » Catalog » SNPs » S735

$18.00

S735
[S735]

S735
hg38 Position: ChrY:15134765..15134765
Ancestral: G
Derived: C
Reference: Jim Wilson
ISOGG Haplogroup: R1b1a1a2a1a2c1k1
Comments: Aka. CTS7030. below L21
Forward Primer: S735_F CAAAAGAGACAAAGAAAAGCACC
Reverse Primer: S735_R CAAGATGGACTCACTTTGAGTTCTAC
Reviews

Customers who bought this product also purchased
L1065
L1065
DYF397
DYF397
FGC173
FGC173
DYS725
DYS725
FGC10125
FGC10125
DYF399X
DYF399X
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies