Top » Catalog » SNPs » FGC9645

$18.00

FGC9645
[FGC9645]

FGC9645
hg38 Position: ChrY:20798315..20798315
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1b2
Comments: Downstream Z2980 > ZP54; Aka ZP60
Forward Primer: FGC9645_F AAGGCCAATCCATTTCACAG
Reverse Primer: FGC9645_R GTCTGAGCAGAGGCCAACTC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies