Top » Catalog » SNPs » M8325

$18.00

M8325
[M8325]

M8325
hg38 Position: ChrY:20731418..20731418
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: unknown
Comments: DYR1
Forward Primer: M8325_F GGGTAGGGAGAAAGGATCACTC
Reverse Primer: M8325_R GGTTGCAGTGAGCCAGGAC
Reviews

Customers who bought this product also purchased
A19146
A19146
A19076
A19076
A19144
A19144
A18899
A18899
A19110
A19110
Z19867
Z19867
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies