Top » Catalog » SNPs » A610

$18.00

A610
[A610]

A610
hg38 Position: ChrY:8374223..8374223
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19602. downstream of CTS6889 / CTS11824
Forward Primer: A610_F CAAAACACCTACACAACTGAACAG
Reverse Primer: A610_R CCATAATTTTGCCTGCATATTAGG
Reviews

Customers who bought this product also purchased
A622
A622
A628
A628
A624
A624
A623
A623
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
A632
A632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies