Top » Catalog » SNPs » Z2123

$18.00

Z2123
[Z2123]

Z2123
hg38 Position: ChrY:14341197..14341197
Ancestral: C
Derived: T
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a1a1b2a2a
Comments: downstream of Z93;Z94;Z95; parallel to Z96 and Z2122; downstream of Z2121
Forward Primer: Z2123v2_F TGGGAAGTTGGGCAACAAC
Reverse Primer: Z2123v2_R GCTGCTATGTCATTAATCAATCTAGAC
Reviews

Customers who bought this product also purchased
FGC57579
FGC57579
Y2569
Y2569
Y879
Y879
FT369423
FT369423
Y878
Y878
FT67857
FT67857
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies