Top » Catalog » SNPs » A796

$19.00

A796
[A796]

A796
hg38 Position: ChrY:10054829..10054829
Ancestral: C
Derived: A
Reference: Richard Cameron (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2 (not listed)
Comments: Downstream of S691
Forward Primer: A796_F GAAAAGGCTTTAGAGACAATGGA
Reverse Primer: A796_R GGCGCTTTCTGTGAATTTCC
Reviews

Customers who bought this product also purchased
A797
A797
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies