Top » Catalog » SNPs » A798

$19.00

A798
[A798]

A798
hg38 Position: ChrY:19082664..19082664
Ancestral: C
Derived: T
Reference: Edwin Holcombe (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A798_F TGGTTACACACCCTGGAAAAGT
Reverse Primer: A798_R CATTTGGGGTTAGCGTCCA
Reviews

Customers who bought this product also purchased
A800
A800
A799
A799
FGC19630
FGC19630
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies