Top » Catalog » SNPs » A802

$18.00

A802
[A802]

A802
hg38 Position: ChrY:8607051..8607051
Ancestral: T
Derived: C
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a1
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A802_F TGGAGGGTGTCTTTCATTGG
Reverse Primer: A802_R GCATGAACCATGACAACGTC
Reviews

Customers who bought this product also purchased
A804
A804
A808
A808
A159
A159
A1133
A1133
A745
A745
A806
A806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies