Top » Catalog » SNPs » A13241

$18.00

A13241
[A13241]

A13241
hg38 Position: ChrY:7676944..7676944
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 F2642+ CTS6772,Y1996+ Y7623+ Y3656+ Branch
Forward Primer: A13241v2_F TCTGAAATATACAATAAGTCAAGGATCG
Reverse Primer: A13241v2_R ACAAAATAGATGCGCTTAACTATCC
Reviews

Customers who bought this product also purchased
BY453
BY453
CTS6364
CTS6364
S1953
S1953
Y3647
Y3647
Z58
Z58
A5989
A5989
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies