Top » Catalog » SNPs » A13241

$18.00

A13241
[A13241]

A13241
hg38 Position: ChrY:7676944..7676944
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-Z140 F2642+ CTS6772,Y1996+ Y7623+ Y3656+ Branch
Forward Primer: A13241v2_F TCTGAAATATACAATAAGTCAAGGATCG
Reverse Primer: A13241v2_R ACAAAATAGATGCGCTTAACTATCC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies