Top » Catalog » SNPs » CTS1313

$18.00

CTS1313
[CTS1313]

CTS1313
hg38 Position: ChrY:7462934..7462934
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3c1b
Comments: Syn. with Z22361; downstream CTS3822 > Z1705
Forward Primer: CTS1313_F TCGTTTGGGAGAAGCTAGTTATGC
Reverse Primer: CTS1313_R AGGTGCTGGGAGGTCCC
Reviews

Customers who bought this product also purchased
CTS2754
CTS2754
M4703
M4703
CTS5961
CTS5961
BY20858
BY20858
U175
U175
CTS6454
CTS6454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies