Top » Catalog » SNPs » CTS6454

$18.00

CTS6454
[CTS6454]

CTS6454
hg38 Position: ChrY:14796209..14796209
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3c1a
Comments: Extracted from 1000 genomes data. Not qualified. Below CTS5788/Z1705
Forward Primer: CTS6454_F TCCATAGGGTGAATTCCTATTTC
Reverse Primer: CTS6454_R CCGCGTACCTGGGACTAC
Reviews

Customers who bought this product also purchased
E Superclade Panel
E Superclade Panel
CTS1313
CTS1313
M4689
M4689
M4670
M4670
Z5966
Z5966
L485
L485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies