Top » Catalog » SNPs » CTS6454

$18.00

CTS6454
[CTS6454]

CTS6454
hg38 Position: ChrY:14796209..14796209
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3c1a
Comments: Extracted from 1000 genomes data. Not qualified. Below CTS5788/Z1705
Forward Primer: CTS6454_F TCCATAGGGTGAATTCCTATTTC
Reverse Primer: CTS6454_R CCGCGTACCTGGGACTAC
Reviews

Customers who bought this product also purchased
M4670
M4670
Z5966
Z5966
L485
L485
Z1704
Z1704
Z22381
Z22381
U175
U175
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies