Top » Catalog » SNPs » CTS668

$18.00

CTS668
[CTS668]

CTS668
hg38 Position: ChrY:7066423..7066423
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3d
Comments: Extracted from 1000 genomes data. Not qualified. Below M4670
Forward Primer: CTS668_F TGCAGTGTTTCCACTGTTCC
Reverse Primer: CTS668_R GCTGAGACAGGCAGATCACC
Reviews

Customers who bought this product also purchased
CTS9387
CTS9387
M267
M267
L335
L335
Y94997
Y94997
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Z834
Z834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies