Top » Catalog » SNPs » CTS668

$18.00

CTS668
[CTS668]

CTS668
hg38 Position: ChrY:7066423..7066423
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3d
Comments: Extracted from 1000 genomes data. Not qualified. Below M4670
Forward Primer: CTS668_F TGCAGTGTTTCCACTGTTCC
Reverse Primer: CTS668_R GCTGAGACAGGCAGATCACC
Reviews

Customers who bought this product also purchased
FGC35964
FGC35964
M184
M184
CTS4625
CTS4625
M96
M96
CTS9387
CTS9387
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies