Top » Catalog » SNPs » Z22636

$18.00

Z22636
[Z22636]

Z22636
hg38 Position: ChrY:8019277..8019277
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3 (not listed)
Comments: below M4670, equiv to Z5976
Forward Primer: Z22636_F TCAGTGATGTATCTAATCCTCCACC
Reverse Primer: Z22636_R ACCAAGCAACTAAGTGATATACAACAC
Reviews

Customers who bought this product also purchased
L335
L335
Z1645
Z1645
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Z834
Z834
FGC35964
FGC35964
M172
M172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies