Top » Catalog » SNPs » Z22636

$18.00

Z22636
[Z22636]

Z22636
hg38 Position: ChrY:8019277..8019277
Ancestral: A
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3 (not listed)
Comments: below M4670, equiv to Z5976
Forward Primer: Z22636_F TCAGTGATGTATCTAATCCTCCACC
Reverse Primer: Z22636_R ACCAAGCAACTAAGTGATATACAACAC
Reviews

Customers who bought this product also purchased
M191
M191
A9891
A9891
Y14890
Y14890
Y96584
Y96584
FT275336
FT275336
A10526
A10526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies