Top » Catalog » SNPs » A16692

$18.00

A16692
[A16692]

A16692
hg38 Position: ChrY:6868869..6868869
Ancestral: A
Derived: G
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b
Comments: Below M84>Y5441>Y5427>Y14899>Y14891>Y16781>Y18621
Forward Primer: A16692_F CAAAATGTCTACATACTGGTGGTCTTATC
Reverse Primer: A16692_R CCATTGTGACATCAAAGGAAAG
Reviews

Customers who bought this product also purchased
DYS714
DYS714
DYS712
DYS712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies