Top » Catalog » SNPs » CTS194

$18.00

CTS194
[CTS194]

CTS194
hg38 Position: ChrY:2932039..2932039
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1b1a1a2a1
Comments: Downstream CTS10323 > CTS10414
Forward Primer: CTS194_F TTTGGTTGGGAAAAACATTTG
Reverse Primer: CTS194_R AATGCAGGCACAGTTGGAG
Reviews

Customers who bought this product also purchased
V4083
V4083
PF2282
PF2282
V22
V22
Z21238
Z21238
L335
L335
Z1231
Z1231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies