Top » Catalog » SNPs » CTS194

$18.00

CTS194
[CTS194]

CTS194
hg38 Position: ChrY:2932039..2932039
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1b1a1a2a1
Comments: Downstream CTS10323 > CTS10414
Forward Primer: CTS194_F TTTGGTTGGGAAAAACATTTG
Reverse Primer: CTS194_R AATGCAGGCACAGTTGGAG
Reviews

Customers who bought this product also purchased
BY148790
BY148790
BY118755
BY118755
BY8823
BY8823
M35.1
M35.1
V6777
V6777
V22
V22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies