Top » Catalog » SNPs » M4437

$18.00

M4437
[M4437]

M4437
hg38 Position: ChrY:7026554..7026554
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1a1a1a1c1a1a3a1a
Comments: Below Z1704/CTS8030
Forward Primer: M4437_F ACCTTGGATTGGCTTTTGTC
Reverse Primer: M4437_R CTTTCTGGGGAGAGTTGGTG
Reviews

Customers who bought this product also purchased
FT203819
FT203819
Z1687
Z1687
M4703
M4703
E Superclade Panel
E Superclade Panel
P177
P177
Y18979
Y18979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies