Top » Catalog » SNPs » A811

$18.00

A811
[A811]

A811
hg38 Position: ChrY:15952760..15952760
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a2a~
Comments: Below Y4882
Forward Primer: A811_F TAGCTGGGACTGTGGGTATG
Reverse Primer: A811_R GCTAAACAGTGCTGCCATTG
Reviews

Customers who bought this product also purchased
Y152112
Y152112
Z17855
Z17855
BY106777
BY106777
A5877
A5877
A1221
A1221
Y151633
Y151633
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies