Top » Catalog » SNPs » A811

$18.00

A811
[A811]

A811
hg38 Position: ChrY:15952760..15952760
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a2a~
Comments: Below Y4882
Forward Primer: A811_F TAGCTGGGACTGTGGGTATG
Reverse Primer: A811_R GCTAAACAGTGCTGCCATTG
Reviews

Customers who bought this product also purchased
Y152112
Y152112
Y97246
Y97246
A14973
A14973
Y13338
Y13338
Y151633
Y151633
A22312
A22312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies