Top » Catalog » SNPs » A813

$18.00

A813
[A813]

A813
hg38 Position: ChrY:12674988..12674988
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Equivalent to PF4135 and Y11765
Forward Primer: A813_F CCGAAAACAATTTTTAAAGACATC
Reverse Primer: A813_R TCTTGCCAAATCTTGTAAGGTG
Reviews

Customers who bought this product also purchased
Y4548
Y4548
C Superclade Panel
C Superclade Panel
F1067
F1067
Y11604
Y11604
F12439
F12439
Y4486
Y4486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies