Top » Catalog » SNPs » Z5978

$18.00

Z5978
[Z5978]

Z5978
hg38 Position: ChrY:12998174..12998174
Ancestral: C
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: E1b1a1a1a1c1a1a3a1b
Comments: Downstream of P252 > Z1704/CTS8030
Forward Primer: Z5978_F AGCTGTGGCCTCGAATGTC
Reverse Primer: Z5978_R AGATCAAATGACAATTTTAATTGGAGAC
Reviews

Customers who bought this product also purchased
FT203819
FT203819
Z1687
Z1687
M4703
M4703
E Superclade Panel
E Superclade Panel
Y18979
Y18979
CTS3274
CTS3274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies