Top » Catalog » SNPs » FGC57768

$18.00

FGC57768
[FGC57768]

FGC57768
hg38 Position: ChrY:13484653..13484653
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S603
Forward Primer: FGC57768v2_F CGATAGTTTCGTTTACAGTGCAGAG
Reverse Primer: FGC57768v2_R AGCTGGAAGCATCATGCTG
Reviews

Customers who bought this product also purchased
R1b Carr Family (Ireland)
R1b Carr Family (Ireland)
Y67105
Y67105
FGC57769
FGC57769
FGC57767
FGC57767
FGC57756
FGC57756
FGC57765
FGC57765
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies