Top » Catalog » SNPs » FGC57771

$18.00

FGC57771
[FGC57771]

FGC57771
hg38 Position: ChrY:16697764..16697764
Ancestral: C
Derived: T
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Aka YFS2759305. Below S603
Forward Primer: FGC57771_F CATATGACACTGGAATCCAGATG
Reverse Primer: FGC57771_R AACCTGGAAAGTCAGGATGTCTC
Reviews

Customers who bought this product also purchased
Y67105
Y67105
FGC57769
FGC57769
FGC57767
FGC57767
FGC57756
FGC57756
R1b Carr Family (Ireland)
R1b Carr Family (Ireland)
FGC57763
FGC57763
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies