Top » Catalog » SNPs » Y14899

$18.00

Y14899
[Y14899]

Y14899
hg38 Position: ChrY:16284030..16284030
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: E1b1b1b2a1a1a1b~
Comments: Below S24051.
Forward Primer: Y14899_F TCAAAATTTCTGCGGACAAG
Reverse Primer: Y14899_R AAATATGACCGGGTGCAGTG
Reviews

Customers who bought this product also purchased
Y22762
Y22762
M84
M84
Y130385
Y130385
BY57152
BY57152
S11387
S11387
FGC71940
FGC71940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies