Top » Catalog » SNPs » FGC57763

$18.00

FGC57763
[FGC57763]

FGC57763
hg38 Position: ChrY:11499051..11499051
Ancestral: G
Derived: A
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S603
Forward Primer: FGC57763_F GACTCGAAAGCAAGGGACTC
Reverse Primer: FGC57763_R ATGCATTCGATTCCATGTTG
Reviews

Customers who bought this product also purchased
FGC57767
FGC57767
R1b Carr Family (Ireland)
R1b Carr Family (Ireland)
Y67105
Y67105
FGC57769
FGC57769
FGC57756
FGC57756
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies