Top » Catalog » SNPs » FGC57765

$18.00

FGC57765
[FGC57765]

FGC57765
hg38 Position: ChrY:12038367..12038367
Ancestral: G
Derived: A
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S603
Forward Primer: FGC57765_F GGGTCTGGGGAACTCTCAG
Reverse Primer: FGC57765_R GACTCAACATTGCACCTTTCC
Reviews

Customers who bought this product also purchased
Y67105
Y67105
FGC57769
FGC57769
FGC57767
FGC57767
R1b Carr Family (Ireland)
R1b Carr Family (Ireland)
FGC57756
FGC57756
FGC57763
FGC57763
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies