Top » Catalog » SNPs » YFS071072

$18.00

YFS071072
[YFS071072]

YFS071072
hg38 Position: ChrY:20533904..20533904
Ancestral: T
Derived: C
Reference: YFull
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: Found in a R1b-L2 person
Forward Primer: YFS071072v2_F GAGAAATAGGAACACTTTTACACTGC
Reverse Primer: YFS071072v2_R ATGAACTCATCATTTTTTATGCCTC
Reviews

Customers who bought this product also purchased
FGC62036
FGC62036
Wish a SNP
Wish a SNP
FGC64538
FGC64538
FGC45679
FGC45679
FGC5306
FGC5306
FGC5303
FGC5303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies