Top » Catalog » SNPs » BY10650

$18.00

BY10650
[BY10650]

BY10650
hg38 Position: ChrY:12195973..12195973
Ancestral: T
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1f1b3~
Comments: Below PF6747
Forward Primer: BY10650_F CAGGCACATGAACTCATGGCCAGC
Reverse Primer: BY10650_R CTCACCACACACAAGCTGGGCTC
Reviews

Customers who bought this product also purchased
BY1098
BY1098
BY11094
BY11094
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies