Top » Catalog » SNPs » A818

$18.00

A818
[A818]

A818
hg38 Position: ChrY:15832423..15832423
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Downstream or equivalent L1402
Forward Primer: A818v2_F TTCAATATCAGCCATATACATACATAGG
Reverse Primer: A818v2_R TTTCATTATTTGCCTTATTGCG
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
FGC3213
FGC3213
L1446
L1446
A426
A426
R1b-DF21 Panel
R1b-DF21 Panel
L1403
L1403
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies