Top » Catalog » SNPs » A16977

$18.00

A16977
[A16977]

A16977
hg38 Position: ChrY:15411053..15411053
Ancestral: A
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: FGC13109 > FGC13140 > FGC39929 > FGC39932
Forward Primer: A16977_F CAAAAAAGAGCCCACATCAG
Reverse Primer: A16977_R GAGAAGTGTCTGTTCATGTCCTTTC
Reviews

Customers who bought this product also purchased
A16978
A16978
DYS391
DYS391
YSEQ-Alpha
YSEQ-Alpha
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies