Top » Catalog » SNPs » BY10485

$18.00

BY10485
[BY10485]

BY10485
hg38 Position: ChrY:12528505..12528505
Ancestral: A
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1b1b~
Comments: Below Y19896
Forward Primer: BY10485_F TTGGAAGAAGAGTGTTCTGGTG
Reverse Primer: BY10485_R GCACCTTGGCAACACTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies