Top » Catalog » SNPs » BY10898

$18.00

BY10898
[BY10898]

BY10898
hg38 Position: ChrY:12601194..12601194
Ancestral: A
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1f1a~ (not listed)
Comments: Below S9747
Forward Primer: BY10898_F GATTTCCTGTTGTCAATGTTGG
Reverse Primer: BY10898_R AACTTTTTGGGTTTTATCATGG
Reviews

Customers who bought this product also purchased
V12
V12
S9747
S9747
Z834
Z834
BY10699
BY10699
PF6751
PF6751
M215
M215
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies