Top » Catalog » SNPs » FGC45218

$18.00

FGC45218
[FGC45218]

FGC45218
hg38 Position: ChrY:15873607..15873607
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a1~
Comments: Below Y6198
Forward Primer: FGC45218_F TCCTCAAAGAATAAGTCTACCTCAAC
Reverse Primer: FGC45218_R CATCATAGGCTTGCTGTTTGC
Reviews

Customers who bought this product also purchased
BY10527
BY10527
M215
M215
BY104490
BY104490
M34
M34
Y6198
Y6198
V22
V22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies