Top » Catalog » SNPs » FGC45218

$18.00

FGC45218
[FGC45218]

FGC45218
hg38 Position: ChrY:15873607..15873607
Ancestral: A
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a1~
Comments: Below Y6198
Forward Primer: FGC45218_F TCCTCAAAGAATAAGTCTACCTCAAC
Reverse Primer: FGC45218_R CATCATAGGCTTGCTGTTTGC
Reviews

Customers who bought this product also purchased
Y29430
Y29430
M96
M96
Z834
Z834
PF6751
PF6751
BY10486
BY10486
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies